Page Banner

United States Department of Agriculture

Agricultural Research Service

Cacao Primers By Name
headline bar

Theobroma cacao microsatellite primers developed by CIRAD and USDA-Miami.

Click on the column title to view the primers sorted by the respective heading.

Primer name Upper Sequence ( 5' - 3' ) Lower Sequence ( 5' - 3' ) Microsatellite Ta Dye Notes
mTcCIR001 gcagggcaggtccagtgaagca tgggcaaccagaaaacgat (ct)14 51 HEX
mTcCIR002 cagggagctgtgttattggtca agttattgtcggcaaggaggat (ga)3N5(ag)2gg(ag)4 51 NED
mTcCIR003 catcccagtatctcatcc ctgctcatttctttcatatca (ct)20(ta)21 ** 61 6-FAM ** Temperature modified from original protocol
mTcCIR004 cgactaaaacccaaaccatcaa aattattaggcaacccgaact (tctctg)2(tc)8 51 6-FAM
mTcCIR006 ttccctctaaactaccctaaat taaagcaaagcaatctaacata (tg)7(ga)13 46 6-FAM
mTcCIR007 atgcgaatgacaactggt gctttcagtcctttgctt (ga)11 51 6-FAM
mTcCIR008 ctagtttcccatttacca tcctcagcattttctttc (tc)5tt(tc)17ttt(ct)4 46 HEX
mTcCIR009 accatgcttcctccttca acatttataccccaacca (ct)8N15(ct)5N9(tc)10 51 NED
mTcCIR010 acagatggcctacacact caagcaagcctcatactc (tg)13 46 NED
mTcCIR011 tttggtgattattagcag gattcgatttgatgtgag (tc)13 46 6-FAM
mTcCIR012 tctgaccccaaacctgta attccagttaaagcacat (cata)4N18(tg)6 ** 59 NED ** Temperature modified from original protocol
mTcCIR013 cagtctaacaaaggtgag tgccccacttgacaacta (ag)13 46 HEX
mTcCIR015 cagccgcctcttgttag tatttgggattcttgatg (tc)19 46 HEX
mTcCIR016 accttcaccagctcacc taaattctactagcaaattacc (tc)9N37(tc)13 46 6-FAM
mTcCIR017 aaggatgaaggatgtaagagag cccatacgagctgtgagt (gt)7N4(ga)12 51 HEX
mTcCIR018 gatagctaaggggattgagga ggtaattcaatcatttgaggata (ga)12 51 6-FAM
mTcCIR019 cacaacccgtgctgatta gttgttgaggttgttaggag (ct)28 46 HEX
mTcCIR021 gtcgttgttgatgtcggt ggtgagtgtgtgtgtttgtct (tc)11N5(ca)12 ** 61 6-FAM ** Temperature modified from original protocol
mTcCIR022 attctcgcaaaaacttag gatggaaggagtgtaaatag (tc)12N146(ct)10 46 HEX
mTcCIR024 tttggggtgatttcttctga tctgtctcgtcttttggtga (ag)13 46 HEX
mTcCIR025 cttcgtagtgaatgtaggag ttaggtaggtagggttatct (ct)21 46 NED
mTcCIR026 gcattcatcaatacattc gcactcaaagttcatactac (tc)9c(ct)4tt(ct)11 46 NED
mTcCIR028 gatcaatcagaagcaaacacat taaagcagcctaccaagaaaag (tc)8 46 NED
mTcCIR029 cgacatttcgactttcatc ttttgtttctttctttttcatt (ca)10 46 HEX
mTcCIR030 tgaagatcctactgttgag tgataataactccttagtgg (ca)11 46 6-FAM
mTcCIR031 gcatgcttctttactcca ttacctgccaatgacttac (gt)12 46 HEX
mTcCIR032 gacttactcccatcctac tgattggcacactttt (ca)10 46 NED
mTcCIR033 tgggttgaagatttggt caacaatgaaaataggca (tg)11 51 6-FAM
mTcCIR034 gaaattgatacaagagaca acataatcttcgcacat (gt)16 46 NED
mTcCIR035 tttccttgtattgaccta atataaacacacttcagagat (gt)11 46 6-FAM
mTcCIR037 ctgggtgctgatagataa aataccctccacacaaat (gt)15 46 HEX
mTcCIR040 aatccgacagtctttaatc cctaggccagagaattga (ac)15 51 NED Same as mTcCir062
mTcCIR042 ttgctgaagtatcttttgac gctccacccctatttg (ca)21 46 HEX
mTcCIR043 tcatgagaatgcatgtg ctggacatgaagaagttat (tg)5(ta)(ga)15 46 6-FAM
mTcCIR044 cccatcaaaagtattagaag atcaagcaatggtcaac (gt)10 51 HEX
mTcCIR045 gtcattgctgtgtg catagcattaactgtgtctg (gt)9 51 6-FAM
mTcCIR046 tatgctctctctcgtataat caagaatgttttgatactga (ct)15(ca)13 46 HEX Same as mTcCir181
mTcCIR047 tttgctttcacatattgag ctccaagtgttttcacca (ca)10 46 NED
mTcCIR048 cagactgccgcacacttag tccatccactcctctcactc (gt)10 51 6-FAM
mTcCIR049 gtaaagcacatatactaaatgtca tttaacctttgtaagaagtattca (tg)8 46 6-FAM
mTcCIR053 ttgactgaaatggtggtaa cagttgactgttgacttgaa (gt)26 51 HEX Same as mTcCir290
mTcCIR054 aacctcttgtcacgtta gaaggcatacttactactgt (ca)15 46 6-FAM
mTcCIR055 gatattgtcccattatttg ttccgccttgttctc (ca)6(gcacac)5 46 NED
mTcCIR056 atacttttacttccttttg tcttatttttctttaccag (tc)14N(tg)15 46 NED
mTcCIR057 tgtagatgtgattttatagtttg ggagggataagaagcag (ac)13 46 HEX
mTcCIR058 tttttggtgatggaactat tggttaagcaacactaaact (gt)40 51 HEX
mTcCIR060 cgctactaacaaacatcaaa agagcaaccatcactaatca (ct)7(ca)20 51 6-FAM
mTcCIR061 gcagtctgaaacaagataa tgactataatataaggcgaa (ca)18 46 6-FAM
mTcCIR062 gttatgtgtatgcttaggc aaatcacacaaacacaaat (gt)20 46 NED Same as mTcCir040
mTcCIR064 gagaaagtaaaaggagagag tgttagagaaatgagaagtg (ga)11 46 HEX Same as mTcCir098
mTcCIR065 catgaaagctaagtgcct aaaaatgcgttacaagtgtg (ga)10 51 NED
mTcCIR066 tatccgccagaaacaga ccaacagtagagtccagagt (ag)20 51 NED
mTcCIR067 atagctccttttgacacga ttctcttttccacctcttt (ga)10 46 6-FAM
mTcCIR068 atttagctgtagccgttt ccagttgatctgcttaatg (ga)17 48 HEX
mTcCIR069 tcggtgttccatcagta catgctatgagattgaaag (ct)20 46 NED
mTcCIR070 ggtatgaaggattgagag ttcctattcgtatttatggg (ga)11 aa(ga)4 46 6-FAM
mTcCIR071 cgactaaccagcagaaac ctcctcctcctccat (ga)10 46 HEX
mTcCIR072 cactaggaaagaggaag aaaagaggaagattgct (ga)10 46 6-FAM
mTcCIR073 ccagtcaaggaagtatct aatgtctgcaatgttagc (ct)4 tt(ct)2 gg(tc)8 46 6-FAM
mTcCIR074 attgcagaagacaacccag ttatgggcgggtgaa (ga)16 gg(ga)9 51 NED
mTcCIR075 cattcatctttttctttctctc tccttctccaaccga (ag)10 48 6-FAM
mTcCIR076 agccaaagaaaggat tgaatccgagacaaag (tc)21 ttt(tc)58 46 HEX Same as mTcCir077
mTcCIR077 gttctcccccactctct aataaataaataaacaatacg (tc)9 46 NED Same as mTcCir076
mTcCIR078 tgaaaatacgttctgtctga caaaaagttttctgaaagtc (tc)2 t(tc)9 46 HEX
mTcCIR079 atttttctttagcgcact taactaccttcccacctc (tc)8 48 6-FAM
mTcCIR080 gctggggtttctttgtatt ttctcatttctttattgggtt (ct)10 cc(ct)2 46 6-FAM
mTcCIR081 tgaaactcccatactactga acaatctgtccattattctg (ct)15 46 NED
mTcCIR082 atcatgtgccccttctaa ggcagctaagtgttcattc (ag)6 aa(ag)7 46 HEX
mTcCIR083 gtgtgtttgtgcatgtgt acccaacccatcacc (tc)8 48 NED
mTcCIR084 catgggacgctgcct ctcttattaaattgaattctct (ga)11 46 6-FAM
mTcCIR085 ttgaagtagagagttgtaagaa ttatggtgttggttgtgat (ag)16 46 NED
mTcCIR086 taacaaggaaaatgctctc gttgaaccgaaggaaag (ct)8 tt (ct)6 48 NED
mTcCIR087 taagggggcaacataaat caaatagcgcagagacaat (ag)21 48 6-FAM
mTcCIR088 ctaggattccatagaagtaa ttggacctcaattatatgt (ct)10 46 NED
mTcCIR089 agagggaaatgaaaacagc gcaatgcacagagaatagtaa (ag)9 51 NED
mTcCIR090 ccacttcaaaaaccattcta gcaactgtcaaccattatcta (ct)10 48 NED
mTcCIR091 ttttgctgagtgttgctgt atccgagaaatagaataggtta (ct)10 46 NED
mTcCIR092 gttccaaatcatctcactt tcgtctatttctcttcactct (ag)9 46 NED
mTcCIR093 gttgccactgctctcgct cccttttattgttccccatta (ct)8 48 6-FAM
mTcCIR094 aatttgtagggtatttgaagag ccatgcccagtgagtag (ag)16 51 HEX
mTcCIR095 ctccttccctttctctc catcgtcttcctctcatc (tc)4 cc (tc)21 48 HEX
mTcCIR096 atagagaaagacccaaatc agacaacaaatttatgtaatg (tc)8 46 6-FAM
mTcCIR097 cttcttctggtcaatcttct gctgcatccatcatcc (tc)3 c(tc)10 46 6-FAM
mTcCIR098 ccagttgctaattttcttc gcacatagttttggcaat (tc)8 46 HEX Same as mTcCir064
mTcCIR099 cggaaaatgaaacagac aataaaagaaaagaaccatac (ga)9 48 NED
mTcCIR100 tgatggaataaactaagaaca taagaagccaggtcagg (ag)6 c(ag)4 48 NED
mTcCIR101 gaactcaccgaagagaaac gagccgtcaccaatgc (tc)18 51 6-FAM
mTcCIR102 ttgtgaaaagattgcga ttgcttgttattgctactat (ga)9 46 6-FAM
mTcCIR103 gagagatggcttaaggat accatactattgaaacattg (ga)10 46 6-FAM
mTcCIR104 aataggaaagggtaagtgaat caagcatataaagccaaca (ga)10 46 HEX
mTcCIR105 gtttacaacttatcgctctg aatttgtatcccttattattta (ct)8 46 NED
mTcCIR106 acgaaaaataccctaaaaa tgctgttgttgtcttgct (ga)9 46 6-FAM
mTcCIR107 ttgcctggaagagaga gatggaaagagaaataatagt (ag)11 46 6-FAM
mTcCIR108 ttctttgtgccctctct ccttcccaacgactatc (ct)15 48 6-FAM
mTcCIR109 ggaaagtgtaggaaagtagac ggaccaaaaagagcata (ct)12 46 HEX
mTcCIR110 gtgaaaagtggggattg taaagtaagagtggtgatggt (ag)8 48 6-FAM
mTcCIR111 ttaataagatccaaccaaca cacattcacccacaagtc (ga)18 46 6-FAM
mTcCIR112 ttactttgtaggctgctg cattccactcattttgct (tc)8 46 6-FAM
mTcCIR113 ggaaagttacagcaagagaga acaagcccggtgaagg (ag)9 51 6-FAM
mTcCIR114 cagatgaatggaataactt gcatgaacacaaacacac (tc)9(tg)5 g(tg)4 48 NED
mTcCIR115 gtgattcaaattcaaatatg aatagcaagagagtgatgag (tc)11 46 NED
mTcCIR116 gaattttgtgatgatggaac cagaggacttgaggcttat (ga)16 aa(ga)10 48 NED
mTcCIR117 tgtggaataaaagagcaat cactggtgtagcaaatgata (tc)10 46 HEX
mTcCIR118 tctgcctgaaaatgtctc tggggcactaacttttg (ga)10 46 HEX
mTcCIR119 tggacttgtgctggaac gcaagaaataaaataggaac (ag)12 46 6-FAM
mTcCIR120 tggaaagtgcttactcttatg tctagtttcaggggctct (ag)13 46 6-FAM
mTcCIR121 catgtgcatttaggtgtc tctggcttcttagtgatac (tg)12 46 HEX
mTcCIR122 catgaaaccagaaaatc atagggtaaagcgaaat (ct)7(ca)14 46 HEX
mTcCIR123 attcccttagctttatgttatg ctcgcgccctttctct (ca)4(tg)6 51 HEX
mTcCIR124 cagcgtcttggaataac acccacacacaagacac (ct)12 46 6-FAM
mTcCIR125 catgcaaatgcttagg tgaaccacagctgacac (tg)11 46 6-FAM
mTcCIR126 aactctcactatcatccac aacaaatcatcaaacactt (ga)11 46 NED
mTcCIR127 cgtttgtcttgcgttc atgtgtttttgcctcttac (tc)8 48 6-FAM
mTcCIR128 tagagagggggtagatga tggaatgatttggagac (ag)20 46 HEX
mTcCIR129 cagtgaggatgaggttc cgacataccagtttacataa (tc)16 46 6-FAM
mTcCIR130 accggcggctgatctac cgcgccaaccaataaag (ag)17 51 6-FAM
mTcCIR131 tgagtaagaaaaagtagaaaa gatcatcggtaaagtaaaat (ga)9 c(ga)4 46 NED
mTcCIR132 gaagccatggttcagag cccagatacaaactaattaaac (tc)10 46 HEX
mTcCIR133 ggatcacatccgtttaga aatttcagccctccaa (ag)11 48 HEX
mTcCIR134 cgtcccaaaatcaacac atagtctgcccttccaa (gt)15 46 HEX
mTcCIR135 attagagagggggtagatga ctagtggggttgacatttg (ag)20 51 NED
mTcCIR136 gaggaggtgagagcca ggtttgtatttttgattgag (ga)7 gc(ga)7 48 NED
mTcCIR137 cagctgtcacggaaac gcctcttaccctcatt (tc)10 46 6-FAM
mTcCIR138 ctgccaagtcaagtaagttc ctgtggtatcaatcaatctaat (ca)11 46 6-FAM
mTcCIR139 cttccctccccaatct ttagctctaggttttccag (tc)10 51 NED
mTcCIR140 gattcatagtggaaacacagt ggaaaacagagaggaagagt (ca)07 48 6-FAM
mTcCIR141 tgttgcataaaacacgagttc cctaaaatccttcctaacagc (tc)14 51 NED
mTcCIR142 ccatttacaactcccattcata aactatccatccaccctacctc (ga)08 48 6-FAM
mTcCIR143 gtgccagcctttttga tcagcccacagaactatg (ga)17 51 HEX
mTcCIR144 ccactgacacgcaatgaa ctaggacttaggaaagtgtttg (tc)09 48 NED
mTcCIR145 cagacttccaactcaaaact tgagaatagatggaccgat (ct)17 48 6-FAM
mTcCIR146 gcaaggtctttttacgat atggacacgtctaagttg (ct)19 46 6-FAM
mTcCIR147 tgaagcaatttgaaatctgt aaccacatcataatgatttaag (tc)16 48 NED
mTcCIR148 cgtcctatcacttctctttc ttgcctttacagccattt (tc)06 cc(tc)06 51 NED
mTcCIR149 atgaagttatagaagggtgtc cattctgaaacaaccaaag (ca)12 46 NED
mTcCIR150 ctgatattgcatggaaa gcaccaaattgatctg (ag)13 46 6-FAM
mTcCIR151 caggggctctgtgttt accaagaacggggaga (ga)12 51 6-FAM
mTcCIR152 cagtagtcaaaacatcaaa gtaatccaaataataagcat (tc)9 cc(tc)15 46 NED
mTcCIR153 gcctctcacaccattatctg tacattcattacttcactgctg (tc)09 51 HEX
mTcCIR154 ccttgtaagtgtggcaat tggaacaagaggttgtca (ga)14 48 HEX
mTcCIR155 cttggactattggaaaac aaggatacaataaggtaaatac (tc)12 46 NED
mTcCIR156 ggcaggaccaaatgat aaaaccaggaacaccag (ct)11 51 HEX
mTcCIR157 actaatgctgttggcttc tcactcgactcgactgtc (ag)09 48 HEX
mTcCIR158 tgtaggttatgcagcgtgttc gatgaggggtgtagctgtttg (ct)08 51 HEX
mTcCIR159 tgggcgatgccaaaag ccacagaactatgtcataggct (ag)07 51 6-FAM
mTcCIR160 gattgttgtttggtatgc gtgaaggtgaaggtgtg (ga)08 48 NED
mTcCIR161 ttggggcactaactttt tttttacattcaattccatc (tc)11 46 6-FAM
mTcCIR162 aagattgaggtcactcagg taagttttttgctttactcttc (ga)19 48 HEX
mTcCIR163 cataacgcagaccagtgt tttgatcatcggcttg (ag)09 48 HEX
mTcCIR164 agaacggttcaggacaatc aggacaatgatgaagaaataag (ct)08 48 6-FAM
mTcCIR165 ttcacttccctccccac ctgggtttggagtagcttg (ct)11 51 6-FAM
mTcCIR166 atgaaccactatgtaagacc attccaaaggattagcag (ct)09(ca)08 48 NED
mTcCIR167 gtagaaccataaacaacatt acaatcattaaaaatacgag (ga)16 46 NED
mTcCIR168 ggtagtattgaggtgcgtat gtgaatgaatggatgtgaaa (tc)9 48 6-FAM
mTcCIR169 cttttggctgtatgttcg ctgccctctctttctcac (ga)9 aa(gt)7 51 HEX
mTcCIR170 ctcttgcacggcacagga ttgccccacccatacg (tg)7 51 6-FAM
mTcCIR171 atttctcatttctcaagtgt tatggcatttcgtagc (gt)20 48 HEX
mTcCIR172 cgttccagtgtgggtga tgttttcgctctactgcttc (tg)9(ag)4 51 6-FAM
mTcCIR173 tccggatggcaatatgt ctaccccatgattctgaact (ca)7 48 HEX
mTcCIR174 tggcagcaatacttcaaa tcccgatgttccactc (tg)7 48 HEX
mTcCIR175 ttacaatcaacagaacctc tatattgatgcgaaagtc (ca)7 46 NED
mTcCIR176 tcaccaattctctgctc aatgaaattacctccttac (tg)16 46 6-FAM
mTcCIR177 gatccttgaaaccacaca taatttctctttacacattctc (ca)7 46 6-FAM
mTcCIR178 catctgtttgcacatatttg gcttggtcccttaacac (tg)8 48 HEX
mTcCIR179 tttccatttctcatttctcaag atgttttcattttcgtatccaa (gt)16 51 NED
mTcCIR180 atggtttcgattgtctgt caaaatctaagctgataaaac (gt)9 46 HEX
mTcCIR181 ctttatgctgtctctcgta ccaagaatgttttgatactg (ct)12(ca)9 46 NED Same as mTcCir046
mTcCIR182 ctaattgttcaaggaggtc aagtgtttttggcactatc (tg)9 46 HEX
mTcCIR183 gttatcttagtttctagccac gtagtcttacaccttgattg (ac)9 46 NED
mTcCIR184 ggttttctagctcctcc aggaaagaatgactcatacta (ca)8(ct)13 48 HEX
mTcCIR185 atccccctgcctaaagag cctgaatgaagtaagacccaat (ca)18 51 6-FAM
mTcCIR186 aaggctaaagaacaaatg cgtagacgtcacacaata (tg)8 46 HEX
mTcCIR187 ttcacctagtgtaatggtct

Last Modified: 4/26/2006